|
Integrated DNA Technologies
m13 forward M13 Forward, supplied by Integrated DNA Technologies, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/forward/M13+Forward/custom%4051-01-13-01%4042301098 Average 94 stars, based on 1 article reviews
m13 forward - by Bioz Stars,
2026-08
94/100 stars
|
Buy from Supplier |
|
Servicebio Inc
u6 forward pcr primer U6 Forward Pcr Primer, supplied by Servicebio Inc, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/forward/primer+snrna+u6/pmc13145395-12-3-8 Average 86 stars, based on 1 article reviews
u6 forward pcr primer - by Bioz Stars,
2026-08
86/100 stars
|
Buy from Supplier |
|
Eurofins
htrac hdr genomic forward primer targeting lha Htrac Hdr Genomic Forward Primer Targeting Lha, supplied by Eurofins, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/forward/and+forward+oligonucleotides+reverse+sgrna/pmc13265900-94-0-10 Average 86 stars, based on 1 article reviews
htrac hdr genomic forward primer targeting lha - by Bioz Stars,
2026-08
86/100 stars
|
Buy from Supplier |
|
Bioneer Corporation
pelb forward primer Pelb Forward Primer, supplied by Bioneer Corporation, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/forward/primer+sequences/pm42321788-80-16-10 Average 86 stars, based on 1 article reviews
pelb forward primer - by Bioz Stars,
2026-08
86/100 stars
|
Buy from Supplier |
|
Citrix Systems Inc
workspace experience service 102 forwards Workspace Experience Service 102 Forwards, supplied by Citrix Systems Inc, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/forward/70+app+workspace/us12652326-189-1-16 Average 86 stars, based on 1 article reviews
workspace experience service 102 forwards - by Bioz Stars,
2026-08
86/100 stars
|
Buy from Supplier |
|
Eurofins
gse310442 oligonucleotides htrac hdr genomic forward primer targeting lha Gse310442 Oligonucleotides Htrac Hdr Genomic Forward Primer Targeting Lha, supplied by Eurofins, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/forward/and+forward+oligonucleotides+reverse+sgrna/10__1016_slash_j__isci__2026__116175-216-32-43 Average 86 stars, based on 1 article reviews
gse310442 oligonucleotides htrac hdr genomic forward primer targeting lha - by Bioz Stars,
2026-08
86/100 stars
|
Buy from Supplier |
|
Eurofins
gagcggagtccgatgtctc forward primer eurofins na mm ccl27a Gagcggagtccgatgtctc Forward Primer Eurofins Na Mm Ccl27a, supplied by Eurofins, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/forward/actctctgc+caaactgctgctcaagctgc+eurofins+human+na+primer+tgggcaagtc+thra/pm42229582-687-181-183 Average 86 stars, based on 1 article reviews
gagcggagtccgatgtctc forward primer eurofins na mm ccl27a - by Bioz Stars,
2026-08
86/100 stars
|
Buy from Supplier |
|
OriGene
origene rplp0 forward Origene Rplp0 Forward, supplied by OriGene, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/forward/RPLP0+(NM_053275)+Human+3'+UTR+Clone/bio_rxiv__64898__2026__05__21__726749-108-5-5 Average 94 stars, based on 1 article reviews
origene rplp0 forward - by Bioz Stars,
2026-08
94/100 stars
|
Buy from Supplier |
|
Fasmac Co Ltd
forward actgggttttacaaacctgtga Forward Actgggttttacaaacctgtga, supplied by Fasmac Co Ltd, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/forward/3+5+ccacgga+gcgagtcctg/pm42167370-68-5-11 Average 86 stars, based on 1 article reviews
forward actgggttttacaaacctgtga - by Bioz Stars,
2026-08
86/100 stars
|
Buy from Supplier |
|
Sangon Biotech
epcam primers forward ttgccgcagctcaggaagaatg reverse gcagccagctttgagcaaatgac Epcam Primers Forward Ttgccgcagctcaggaagaatg Reverse Gcagccagctttgagcaaatgac, supplied by Sangon Biotech, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/forward/aagccagcgaggtaggaaggtag+cacttgtgttgctgcctctcctc+forward+primers+reverse+wdr77/pmc13145899-52-0-5 Average 86 stars, based on 1 article reviews
epcam primers forward ttgccgcagctcaggaagaatg reverse gcagccagctttgagcaaatgac - by Bioz Stars,
2026-08
86/100 stars
|
Buy from Supplier |